The ribosomal genes of Mycoplasma capricolum.
نویسندگان
چکیده
The nucleotide sequence of 5S rRNA from Mycoplasma capricolum is more similar to that of the gram-positive bacteria than that of the gram-negative bacteria. The presence of two copies of rRNA genes in M. capricolum genome has been demonstrated. The two different rRNA gene clusters have been cloned in E. coli plasmid vectors and analyzed for the rRNA gene organizations, demonstrating that the gene arrangement is in the order of 16S, 23S, and 5S rDNA. The ribosomes of M. capricolum contain about 30 species of proteins in 50S and 20 in 30S subunits. The number and size of the ribosomal proteins are not significantly different from those of other eubacterial ribosomes.
منابع مشابه
Preferential use of A- and U-rich codons for Mycoplasma capricolum ribosomal proteins S8 and L6.
The nucleotide sequence of the 1.3 kilobase-pair DNA segment, which contains the genes for ribosomal proteins S8 and L6, and a part of L18 of Mycoplasma capricolum, has been determined and compared with the corresponding sequence in Escherichia coli (Cerretti et al., Nucl. Acids Res. 11, 2599, 1983). Identities of the predicted amino acid sequences of S8 and L6 between the two organisms are 54%...
متن کاملMolecular evolution of Mycoplasma capricolum subsp. capripneumoniae strains, based on polymorphisms in the 16S rRNA genes.
Mycoplasma capricolum subsp. capripneumoniae belongs to the so-called Mycoplasma mycoides cluster and is the causal agent of contagious caprine pleuropneumonia (CCPP). All members of the M. mycoides cluster have two rRNA operons. The sequences of the 16S rRNA genes of both rRNA operons from 20 strains of M. capricolum subsp. capripneumoniae of different geographical origins in Africa and Asia w...
متن کاملDetection of Mcs4 Rna Genes in Mycoplasma Capricolum Subsp. Capricolum Type Strain California Kid and Strain Gm262g
MCS4 RNA (125 nucleotides in length) is as abundant 5S rRNA in the cell and is encoded by two genes – mcs4a and mcs4b. We detected MCS4 RNA genes by random amplified polymorphic analysis (RAPD) and Southern hybridization technique. In our studies the genomic polymorphisms of Mycoplasma capricolum subsp. capricolum type strain California kid (ATCC 27343) and strain GM262G (ATCC 43092) were not d...
متن کاملPromoters of Mycoplasma capricolum ribosomal RNA operons: identical activities but different regulation in homologous and heterologous cells
The 5' region of the rRNA operon, rrnA, of M. capricolum was cloned. Sequence analysis revealed two tRNA genes, tRNA(leu) and tRNA(lys), upstream to the promoter of the rRNA operon. The in vivo transcription start sites of the rRNA operon and of the tRNA genes were mapped. The same promoters used by M. capricolum RNA polymerase are also recognized by E. coli RNA polymerase both in vivo and in v...
متن کاملThe nucleotide sequence of 5S rRNA from Mycoplasma capricolum.
The nucleotide sequence of 5S rRNA from Mycoplasma capricolum is UUGGUGGUAUAGCAUAGAGGUCACACCUGUUCCCAUGCCGAACACAGAAGUUAAGCUCUAUUACGGUGAAGAUAUUACU GAUGUGAGAAAAUAGCAAGCUGCCAGUUOH. The length is 107 nucleotides long, and the shortest in all the 5S rRNAs so far known. The sequence is more similar to those of the gram-positive bacteria than those of the gram-negative bacteria.
متن کاملذخیره در منابع من
با ذخیره ی این منبع در منابع من، دسترسی به آن را برای استفاده های بعدی آسان تر کنید
برای دانلود متن کامل این مقاله و بیش از 32 میلیون مقاله دیگر ابتدا ثبت نام کنید
ثبت ناماگر عضو سایت هستید لطفا وارد حساب کاربری خود شوید
ورودعنوان ژورنال:
- The Yale Journal of Biology and Medicine
دوره 56 شماره
صفحات -
تاریخ انتشار 1983